reference stringlengths 7 774 ⌀ | aptamer_chemistry stringclasses 21
values | aptamer_name stringlengths 1 164 | target_name stringlengths 2 1.2k ⌀ | aptamer_sequence stringlengths 3 374 ⌀ | origin stringclasses 6
values | target_chemistry stringclasses 11
values | external_id nullclasses 509
values | target_sequence nullclasses 356
values | new_affinity stringlengths 3 193 ⌀ | entry_id float64 0 3.61k ⌀ | page stringlengths 44 44 ⌀ |
|---|---|---|---|---|---|---|---|---|---|---|---|
Kimoto M., Nakamura M., Hirao I. July 7 2016. Post-ExSELEX stabilization of an unnatural-base DNA aptamer targeting VEGF165 toward pharmaceutical applications. Nucleic Acids Research 44(15): 7487-7494.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | Anti-VEGF165 Unnatural Base DNA Aptamer #4 (ID# 7985) | VEGF165 | GCGGTAAACTGCGTCCGAAGGGGCTGCAGTGACCCGAATGGGTCCGCCGCGAAGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.9 pM | 0 | https://jc-biotechaiteam.com/AptaCom/0000-2/ |
Li M., Huanh Z., Du L., Altier C., Fang H., Wang B. 2008. Selecting Aptamers for a Glycoprotein through the Incorporation of the Boronic Acid Moiety. Journal of American Chemical SOciety 138(38): 12636-12638.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Fibrinogen (85A) (T-Modified) (ID# 7986) | Fibrinogen | CCTTCGTTGTCTGCCTTCGTAGCGGATCGAATTACGCGTTAACGGCAACCGATAACGGGACCGATTGCACACCCTTCAGAATTCGCACCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 6.2 µM | 1 | https://jc-biotechaiteam.com/AptaCom/0001-2/ |
Ferreira, C.S.; Cheung, M.C.; Missailidis, S.; Bisland, S.; Gariepy, J. Phototoxic aptamers selectively enter and kill epithelial cancer cells. Nucleic acids research 2009, 37, 866-876.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | 5TRG2 (ID# 7987) | MUC1-5TR-GalNAc; Tn antigen | GAGACAAGAATAAACGCTCAAGGCTATAGCACATGGGTAAAACGACTTCGACAGGAGGCTCACAACAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 18.6 nM | 2 | https://jc-biotechaiteam.com/AptaCom/0002-2/ |
Zhao, N, Pei, S-N, Qi, J, Zeng, Z, Iyer, SP, Lin, P, et al. (2015). Oligonucleotide aptamer-drug conjugates for targeted therapy of acute myeloid leukemia. Biomaterials 67: 42-51Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | 1-F (ID# 7988) | CD117 | GAGGCATACCAGCTTATTATTGGGGCCGGGGCAAGGGGGGGGTACCGTGGTAGGACAGATAGTAAGTGCAATCTGCGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.24 nM | 3 | https://jc-biotechaiteam.com/AptaCom/0003-2/ |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HupB-4T (ID# 7989) | HupB | GGGTAGCAGATGGGGGGGGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.72 µM | 4 | https://jc-biotechaiteam.com/AptaCom/0004-2/ |
Powell Gray B, Kelly L, Ahrens DP et al. Tunable cytotoxic aptamer-drug conjugates for the treatment of prostate cancer. Proc. Natl. Acad. Sci. U.S.A. doi: 10.1073/pnas.1717705115 (2018)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | DL650-E3 (ID# 7990) | PC-3 | GGCUUUCGGGCUUUCAACAUCAGCCCCUCAGCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 146 nM | 5 | https://jc-biotechaiteam.com/AptaCom/0005-2/ |
Zhang R, Gu Y, Wang Z, Li Y, Fan Q, Jia Y. Aptamer cell sensor based on porous graphene oxide decorated ion-selective-electrode: Double sensing platform for cell and ion. Biosensors and Bioelectronics. 2018 Jun 15.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | AS1411 (ID# 7991) | non-small lung cancer cell A549 | GGTGGTGGTGGTTGTGGTGGTGGTGG | https://www.aptagen.com/apta-index/ | Cells | null | null | null | 6 | https://jc-biotechaiteam.com/AptaCom/0006-2/ |
Zhu, Lianhua et al. ƒ??CAIX aptamer-functionalized targeted nanobubbles for ultrasound molecular imaging of various tumorsƒ? International journal of nanomedicine vol. 13 6481-6495. 16 Oct. 2018, doi:10.2147/IJN.S176287Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Carbonic Anhydrase IX Aptamer (ID# 7992) | Carbonic anhydrase IX | AGCAGCACAGAGGTCAGATGTGGTGCGCAGTGATGTGGTTGGTCCTATGCGTGCTACCGTCCTATGCGTGCTACCGTGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | n.d. nM | 7 | https://jc-biotechaiteam.com/AptaCom/0007-2/ |
V. C. ??zalp, D. ??am, F. J. Hernandez, L. I. Hernandez, T. Sch??fer, and H. A. ??ktem, Small molecule detection by lateral flow strips via aptamer-gated silica nanoprobes, Analyst, 2016, 141, 2595.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Huizenga ATP-Binding aptamer (ID# 7993) | ATP | CACCTGGGGGAGTATTGCGGAGGAAGGTTCCAGGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 956 µM | 8 | https://jc-biotechaiteam.com/AptaCom/0008-2/ |
Liang S, Kinghorn AB, Voliotis M, et al. Measuring luteinising hormone pulsatility with a robotic aptamer-enabled electrochemical reader. Nat Commun. 2019;10(1):852. Published 2019 Feb 20. doi:10.1038/s41467-019-08799-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | B23 LH aptamer (ID# 7995) | luteinising hormone | TATGGTATGCTGTGTGGTATGGGGTGGCGTGCTCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 321 nM | 9 | https://jc-biotechaiteam.com/AptaCom/0009-2/ |
Aptamer-Based Sandwich Assay for Measurement of Thymidine Kinase 1 in Serum of Cancerous Patients Mahmood Nazari, Seyed Latif Mousavi Gargari, Abbas Sahebghadam Lotfi, Mohammad Javad Rassaee, and Ramezan Ali Taheri Biochemistry 2019 58 (18), 2373-2383Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apt37 (ID# 7996) | Thymidine Kinase 1 | CGGTGCAGTGGATACATGCCAGCCGTAGCCATCGTGGATA | https://www.aptagen.com/apta-index/ | Protein | null | null | 570 pM | 10 | https://jc-biotechaiteam.com/AptaCom/0010-2/ |
Aptamer-Based Sandwich Assay for Measurement of Thymidine Kinase 1 in Serum of Cancerous Patients Mahmood Nazari, Seyed Latif Mousavi Gargari, Abbas Sahebghadam Lotfi, Mohammad Javad Rassaee, and Ramezan Ali Taheri Biochemistry 2019 58 (18), 2373-2383Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apt69 (ID# 7997) | Thymidine Kinase 1 | GCGTGCAGCATGACCACCGATGTCACACTTAATGAGAAT | https://www.aptagen.com/apta-index/ | Protein | null | null | 510 pM | 11 | https://jc-biotechaiteam.com/AptaCom/0011-2/ |
Colombo, M., Masiero, S., Rosa, S., Caporali, E., Toffolatti, S. L., Mizzotti, C., Tadini, L., Rossi, F., Pellegrino, S., Musetti, R., Velasco, R., Perazzolli, M., Vezzulli, S., & Pesaresi, P. (2020). Nopv1: A synthetic antimicrobial peptide aptamer targeting the causal agents of grapevine downy mildew and potato late blight. Scientific Reports, 10(1). https://doi.org/10.1038/s41598-020-73027-xMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Peptide | NoPv1 (ID# 8199) | PvCesA2 | ATAGCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 12 | https://jc-biotechaiteam.com/AptaCom/0012-2/ |
P Polo. Selection, characterisation and analytical application of DNA aptamer against the anaphylactic toxic allergen, β-conglutin, Lup an 1. (Doctoral Thesis). Retrieved from Tesis Doctorals en Xarxa. http://hdl.handle.net/10803/84036.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lup an 1 allergen β-conglutin (SGQ) (ID# 7785) | β-conglutin | GGTGGGGGTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.58 nM | 13 | https://jc-biotechaiteam.com/AptaCom/0013-2/ |
Kazuyoshi Murakami, Fumiko Nishikawa, Ken Noda, Takashi Yokoyama & Satoshi Nishikawa (2008) Anti-bovine Prion protein RNA aptamer containing tandem GGA repeat interacts both with recombinant bovine prion protein and its β isoform with high affinity, Prion, 2:2, 73-80Tsukasa Mashima, Akimasa Matsugami, Fumiko Nishikawa, Satoshi Nishikawa, Masato Katahira, Unique quadruplex structure and interaction of an RNA aptamer against bovine prion protein, Nucleic Acids Research, Volume 37, Issue 18, 1 October 2009, Pages 6249–6258, https://doi.org/10.1093/nar/gkp647Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | R12 (ID# 8217) | Bovine PrP; beta Bovine PrP | GGAGGAGGAGGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 8.5; 280 nM | 14 | https://jc-biotechaiteam.com/AptaCom/0014-2/ |
Singh NK, Ray P, Carlin AF, Magallanes C, Morgan SC, Laurent LC, Aronoff-Spencer ES, Hall DA. "Hitting the diagnostic sweet spot: Pont-of-care SARS-CoV-2 salivary antigen testing with an off-the-shelf gluocometer". medRxiv preprint. doi: https://doi.org/10.1101/2020.09.24.20200394.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer 1 – Switch antisense (ID# 8040) | SARS-CoV nucleocapsid, SARS-CoV-2 nucleocapsid | GACCGCCCCAGCCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.93 nM | 15 | https://jc-biotechaiteam.com/AptaCom/0015-2/ |
Macdonald, J., Houghton, P., Xiang, D., Duan, W., & Shigdar, S. (2016). Truncation and Mutation of a Transferrin Receptor Aptamer Enhances Binding Affinity. Nucleic Acid Therapeutics, 26(6), 348–354. doi:10.1089/nat.2015.0585Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | TfRA4 (ID# 8192) | TfR-positive cells | GCGTCGTACCACGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 487.3 ±108.8 nM nM | 16 | https://jc-biotechaiteam.com/AptaCom/0016-2/ |
Bock, Louis, et al. "Selection of single-stranded DNA molecules that bind and inhibit human thrombin." Nature 355, (1992): 564-566. S Uehara et al. 30 Poly(dA)-Tailed Thrombin DNA Aptamer to Increase DNase-Resistance and Clotting Inhibitory Activity. Bull. Chem. Soc. Jpn. 81(2008): 1485ƒ??1491Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Thrombin (15mer) (ID# 7480) | Thrombin | GGTTGGTGTGGTTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 84 nM | 17 | https://jc-biotechaiteam.com/AptaCom/0017-2/ |
B-F Ye et al. "Colorimetric photonic hydrogel aptasensor for the screening of heavy metal ions." Nanoscale 4(2012): 5998-6003.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Lead (Pb) binding aptamer (ID# 7709) | Lead (Pb) | GGTTGGTGTGGTTGG | https://www.aptagen.com/apta-index/ | Other | null | null | null | 18 | https://jc-biotechaiteam.com/AptaCom/0018-2/ |
Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, ƒ??RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Methodƒ? Biol. Pharm. Bull. 37(8) 1411-1415 (2014)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Short Mitomer2 (ID# 7930) | Mitochondria | CUUAGCCCAUAGCUGGCUGC | https://www.aptagen.com/apta-index/ | Other | null | null | . nM | 19 | https://jc-biotechaiteam.com/AptaCom/0019-2/ |
Singh NK, Ray P, Carlin AF, Magallanes C, Morgan SC, Laurent LC, Aronoff-Spencer ES, Hall DA. "Hitting the diagnostic sweet spot: Pont-of-care SARS-CoV-2 salivary antigen testing with an off-the-shelf gluocometer". medRxiv preprint. doi: https://doi.org/10.1101/2020.09.24.20200394.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SARS-CoV-2 Aptamer 1C – Apta-switch antisense (ID# 8041) | RBD of the Spike glycoprotein from SARS-CoV-2 | TGTCCATTAACGCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 5.8 nM | 20 | https://jc-biotechaiteam.com/AptaCom/0020-2/ |
doi:10.1016/j.aca.2013.09.060Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Thiol-modified thrombin Aptamer (ID# 8159) | Thrombin | CGGTTGGTGTGGTTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 21 | https://jc-biotechaiteam.com/AptaCom/0021-2/ |
Müller, J., Wulffen, B., Pötzsch, B., & Mayer, G. (2007). Multidomain Targeting Generates a High-Affinity Thrombin-Inhibiting Bivalent Aptamer. ChemBioChem, 8(18), 2223–2226. doi:10.1002/cbic.200700535Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Thrombin (ID# 8194) | α-thrombin | GGTTGGTGTTGTTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 123.1 nM | 22 | https://jc-biotechaiteam.com/AptaCom/0022-2/ |
Wei, Hao et al. “Screening and application of a truncated aptamer for high-sensitive fluorescent detection of metronidazole.” Analytica chimica acta vol. 1128 (2020): 203-210. doi:10.1016/j.aca.2020.07.003Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | AP32-4 (ID# 8118) | Metronidazole | CTGTTTGGTAGGCAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 77.22 ± 11.27 nM | 23 | https://jc-biotechaiteam.com/AptaCom/0023-2/ |
https://doi.org/10.1016/j.molliq.2019.111159.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | T30695 (ID# 8164) | Pb2 | GGGTGGGTGGGTGGGT | https://www.aptagen.com/apta-index/ | Other | null | null | null | 24 | https://jc-biotechaiteam.com/AptaCom/0024-2/ |
https://doi.org/10.1016/j.molliq.2019.111159.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M4 (ID# 8165) | Pb2 | GGGAGGGTGGGTGGGT | https://www.aptagen.com/apta-index/ | Other | null | null | null | 25 | https://jc-biotechaiteam.com/AptaCom/0025-2/ |
https://doi.org/10.1016/j.molliq.2019.111159.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M16 (ID# 8166) | Pb2 | GGGTGGGTGGGTGGGA | https://www.aptagen.com/apta-index/ | Other | null | null | null | 26 | https://jc-biotechaiteam.com/AptaCom/0026-2/ |
https://doi.org/10.1016/j.molliq.2019.111159.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | M4-16 (ID# 8167) | Pb2 | GGGAGGGTGGGTGGGA | https://www.aptagen.com/apta-index/ | Other | null | null | null | 27 | https://jc-biotechaiteam.com/AptaCom/0027-2/ |
Shigdar, S. et al. Nov 19, 2012. "RNA aptamers targeting cancer stem cell marker CD133." Elsevier. Cancer Letters.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | CD133-A15 (ID# 8149) | AC133 epitope (CD133) | CCCUCCUACAUAGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 83.2 ± 82.9 nM | 28 | https://jc-biotechaiteam.com/AptaCom/0028-2/ |
Chen, X., Zhang, Y., Shi, Y., Niu, T., Li, B., & Guo, L. et al. (2021). Evolution of DNA aptamers against esophageal squamous cell carcinoma using cell-SELEX. The Analyst, 146(13), 4180-4187. doi: 10.1039/d1an00634gMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | S3-2-3 (ID# 8178) | Esophageal cancer cells. | ATGGCCAGGGGGGAGGGG | https://www.aptagen.com/apta-index/ | Cells | null | null | 265 nM | 29 | https://jc-biotechaiteam.com/AptaCom/0029-2/ |
Sekkai et al. "In Vitro Selection of DNA Aptamers Against the HIV-1 TAR RNA Hairpin." Antisense and Nucleic Acid Drug Development, 12 (2002): 265-274.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HIV-1 TAR RNA Hairpin Loop (B22-19) (ID# 7473) | HIV-1 TAR RNA Hairpin Loop | CCCTAGTTAGCCATCTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 50 nM | 30 | https://jc-biotechaiteam.com/AptaCom/0030-2/ |
Meyer C, U Hahn, et al. (2012) Interleukin-6 Receptor specific RNA aptamers for cargo delivery into target cells. RNA BiolMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Interleukin-6 receptor (AIR-3A) (ID# 7839) | Cells presenting IL-6R | GGGGAGGCUGUGGUGAGGG | https://www.aptagen.com/apta-index/ | Cells | null | null | 8.5 nM | 31 | https://jc-biotechaiteam.com/AptaCom/0031-2/ |
Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ampicillin (AMP17) (ID# 7854) | Ampicillin | GCGGGCGGTTGTATAGCGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 13.4 nM | 32 | https://jc-biotechaiteam.com/AptaCom/0032-2/ |
Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ampicillin (AMP18) (ID# 7855) | Ampicillin | TTTAGTTGGGGTTCAGTTG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 9.8 nM | 33 | https://jc-biotechaiteam.com/AptaCom/0033-2/ |
Bell DR, Weber JK, Yin W, Huynh T, Duan W, Zhou R. In silico design and validation of high-affinity RNA aptamers targeting epithelial cellular adhesion molecule dimers. Proc Natl Acad Sci U S A. 2020 Apr 14;117(15):8486-8493. doi: 10.1073/pnas.1913242117. Epub 2020 Mar 31. Erratum in: Proc Natl Acad Sci U S A. 2021 Feb 16;118(7): PMID: 32234785; PMCID: PMC7165443.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | EP23 (ID# 8104) | Epithelial cellular activating molecule (EpCAM) | ACGUAUCCCUUUUCGCGUA | https://www.aptagen.com/apta-index/ | Cells | null | null | 39.89 nM | 34 | https://jc-biotechaiteam.com/AptaCom/0034-2/ |
Yu, H., Canoura, J., Guntupalli, B., Lou, X., & Xiao, Y. (2017). A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva. Chemical Science, 8(1), 131–141. doi:10.1039/c6sc01833eMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | CBSA-5335 SF (ID# 8120) | Cocaine | GAGACAAGGGACAAGGAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 36 nM | 35 | https://jc-biotechaiteam.com/AptaCom/0035-2/ |
Shigdar, S. et al. Nov 19, 2012. "RNA aptamers targeting cancer stem cell marker CD133." Elsevier. Cancer Letters.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | CD133-B19 (ID# 8150) | CD133 | CAGAACGUAUACUAUUCUG | https://www.aptagen.com/apta-index/ | Protein | null | null | 145.1±75.4 nM | 36 | https://jc-biotechaiteam.com/AptaCom/0036-2/ |
Song KM, Jeong E, Jeon W, Cho M, Ban C. Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 2012 Feb;402(6):2153-61. doi: 10.1007/s00216-011-5662-3. Epub 2012 Jan 7. PMID: 22222912.https://pubmed.ncbi.nlm.nih.gov/28917799/Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | AMP18 (ID# 8232) | Ampcillin | TTAGTTGGGGTTCAGTTGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 9.8 nM | 37 | https://jc-biotechaiteam.com/AptaCom/0037-2/ |
S Shigdar et al. RNA aptamer against a cancer stem cell marker epithelial cell adhesion molecule. Cancer Sci 102(2011): 991-998.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Epithelial cell adhesion molecule (EpCAM) (EpDT3) (ID# 7739) | Cancer stem cell marker epithelial cell adhesion molecule | GCGACUGGUUACCCGGUCGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 54.5 nM | 38 | https://jc-biotechaiteam.com/AptaCom/0038-2/ |
Zhu L, et al. (2012) In vitro selection of highly efficient G-quadruplex-based DNAzymes. Anal. Chem. 84: 8383-8390.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Peroxidase DNAzyme ([B7]-3-0) (ID# 7834) | Hemin | ATTGGGAGGGATTGGGTGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 29 nM | 39 | https://jc-biotechaiteam.com/AptaCom/0039-2/ |
Yang, M. et al. "Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery." Journal of Hematology & Oncology 2014, 7:5.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | K19 (ID# 7881) | Siglec-5 | GACGCTTACTCAGGTGTGACTCGAAGGGGTTGGGTGGGTTTATACAAATTAATTAATATTGTATGGTATATTTCGAAGGACGCAGATGAAGTCTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 12.37 nM | 40 | https://jc-biotechaiteam.com/AptaCom/0040-2/ |
Tsao, Shih-Ming, et al. “Generation of aptamers from a primer-free randomized ssDNA library using magnetic-assisted rapid aptamer selection.” Scientific Reports 7, (2017): 1-11.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PF20N-RO-MARAS-84-1 (ID# 8018) | C-reactive Proteins (CRP) | GTTGACGGGCGATTGGTCTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 23.58 nM | 41 | https://jc-biotechaiteam.com/AptaCom/0041-2/ |
Haberland, A., et al. "Aptamer Neutralization of Beta1-Adrenoceptor Autoantibodies Isolated From Patients With Cardiomyopathies." Circulation Research, 109 (2011): 986-992.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti -?1-Adrenergic Receptor-Autoantibodies (Aptamer 110) (ID# 7665) | ?1-Adrenoceptor Autoantibodies(AABs) | ACAGTAACCGCGTGAGGTCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | n/a nM | 42 | https://jc-biotechaiteam.com/AptaCom/0042-2/ |
Song KM, Jeong E, Ban C, et al. (2012) Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal Bioanal Chem. 402:2153-2161.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ampicillin (AMP4) (ID# 7853) | Ampicillin | CACGGCATGGTGGGCGTCGTG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 9.4 nM | 43 | https://jc-biotechaiteam.com/AptaCom/0043-2/ |
Nguyen. Label Free detection of Aflatoxin M1 with electrochemical Fe3O4/polyaniline-based aptasensorMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti Aflatoxin M1 (ID# 7867) | Aflatoxin M1 | ACTGCTAGAGATTTTCCACAT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.0182 nM | 44 | https://jc-biotechaiteam.com/AptaCom/0044-2/ |
Kyung-Mi Song, Minseon Cho, Hunho Jo, Kyoungin Min, Sung Ho Jeon, Taisun Kim, Min Su Han, Ja Kang Ku, Changill Ban, "Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer". Anal. Biochem. 415 (2011) 175-181.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ky2 Aptamer (ID# 7908) | Kanamycin | TGGGGGTTGAGGCTAAGCCGA | https://www.aptagen.com/apta-index/ | Other | null | null | 78.8 nM | 45 | https://jc-biotechaiteam.com/AptaCom/0045-2/ |
A. Ono and H. Togashi. "Highly selective oligonucleotide-based sensor for mercury(II) in aqueous solutions." Angew. Chem. Int. Ed. 43(2004):4300-4302.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Mercury II (Hg2+) (ID# 7707) | Mercury II (Hg2+) | TTCTTTCTTCCCCTTGTTTGTT | https://www.aptagen.com/apta-index/ | Other | null | null | null | 46 | https://jc-biotechaiteam.com/AptaCom/0046-2/ |
Gupta, Shashi, et al. "Chemically modified DNA aptamers bind interleukin-6 with high affinity and inhibit signaling by blocking its interaction with interleukin-6 receptor." Journal of Biological Chemistry 289.12 (2014): 8706-8719.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | SL1025 (ID# 7973) | Interleukin 6 (IL-6), cytokine | GGCAGGGGAAACACGAAGCGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.2 nM | 47 | https://jc-biotechaiteam.com/AptaCom/0047-2/ |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Human Immunoglobulin G (IgG) (Apt 8) (ID# 7461) | hlgG-Fc | GGAGGUGCUCCGAAAGGAACUCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 75 nM | 48 | https://jc-biotechaiteam.com/AptaCom/0048-2/ |
Apiwat et al. Graphene based aptasensor for glycated albuminin diabetes mellitus diagnosis and monitoring. Biosensors and Bioelectronics 82(2016)140ƒ??145.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Glycated human serum albumin (GHSA) (ID# 7967) | GHSA | TGCGGTTGTAGTACTCGTGGCCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 5.78 µM | 49 | https://jc-biotechaiteam.com/AptaCom/0049-2/ |
K Tsukakoshi. Selection of DNA aptamers that recognize a-synuclein oligomers using a competitive screening method. Anal Chem. 84(2012): 5542-5547Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | a-Synuclein Oligomers (T-SO508) (ID# 7728) | a-synuclein oligomers | GCCTGTGGTGTTGGGGCGGGTGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 68 nM | 50 | https://jc-biotechaiteam.com/AptaCom/0050-2/ |
Mashima, T., Lee, JH., Kamatari, Y.O. et al. Development and structural determination of an anti-PrPC aptamer that blocks pathological conformational conversion of prion protein. Sci Rep 10, 4934 (2020).Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | R24 (ID# 8215) | Bovine PrP | GGAGGAGGAGGAGGAGGAGGAGGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 61 nM | 51 | https://jc-biotechaiteam.com/AptaCom/0051-2/ |
Huizenga and Szostak. "A DNA Aptamer That Binds Adenosine and ATP." Biochemistry, 34 (1995): 656-665.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Adenosine/ATP (DH25.42) (ID# 7509) | Adenosine and ATP | CCTGGGGGAGTATTGCGGAGGAAGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 6 µM | 52 | https://jc-biotechaiteam.com/AptaCom/0052-2/ |
Liu et al. "Dissection of the Functional Structure of Aptamer17, Which Specifically Recognizes Differential PC12 Cells." Nucleic Acid Therapeutics, 21(2011): 225-229. Wang et al. "Single-stranded DNA Aptamers thatBbind Differentiated but not Parental Cells: Subtractive Systematic Evolution of Ligands by Exponential Enrichment." J. Biotechnol., 102(2003): 15-22.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PC12 Cells (Aptamer17a) (ID# 7618) | PC12 Cells | GGTTGGATGTAAGGTTGGAGGGGGG | https://www.aptagen.com/apta-index/ | Cells | null | null | null | 53 | https://jc-biotechaiteam.com/AptaCom/0053-2/ |
Nonaka,Y., Sode, K., and Ikebukuro, K.(2010) "Screening and Improvement of an Anti-VEGF DNA Aptamer." Molecules, 15, 215-225.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | V7t1 targeting VEGF-121 (ID# 7733) | VEGF-121 | TGTGGGGGTGGACGGGCCGGGTAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.1 nM | 54 | https://jc-biotechaiteam.com/AptaCom/0054-2/ |
Nonaka,Y., Sode, K., and Ikebukuro, K.(2010) "Screening and Improvement of an Anti-VEGF DNA Aptamer." Molecules, 15, 215-225. Stejskalov?, Anna & Oliva, Nuria & J England, Frances & Almquist, Benjamin. (2019). Biologically Inspired, Cell-Selective Release of Aptamer-Trapped Growth Factors by Traction Forces. Advanced Materials. 1806380. 10.1002/adma.201806380.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | V7t1 targeting VEGF-165 (ID# 7734) | VEGF-165 | TGTGGGGGTGGACGGGCCGGGTAGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.4 nM | 55 | https://jc-biotechaiteam.com/AptaCom/0055-2/ |
E Orava et al. A short DNA aptamer that recognizes TNFa and blocks its activity in vitro. ACS Chem. Biol. (2012) Accepted for print. DOI: 10.1021/cb3003557.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Tumor necrosis factor-alpha (TNFa) (VR11) (ID# 7741) | Tumor necrosis factor-alpha (TNFa) | TGGTGGATGGCGCAGTCGGCGACAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 7 nM | 56 | https://jc-biotechaiteam.com/AptaCom/0056-2/ |
Y Li, CR Geyer, and D Sen. (1996) Recognition of anionic porphyrins by DNA aptamers. Biochem. 35:6911-6922.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anionic Porphyrins (ST1) (ID# 7849) | N-methylmesoporphyrin IX (NMM), mesoporphyrin IX (MPIX), and other metalloderivatives | AACGTGGGAGGGCGGTGGTGTTGAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.7 µM | 57 | https://jc-biotechaiteam.com/AptaCom/0057-2/ |
D Seleci et al. Aptamer mediated niosomal drug delivery. RSC Adv 6(2016): 87910-87918.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | S2.2 (ID# 7974) | MUC1 | GCAGTTGATCCTTTGGATACCCTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.135 nM | 58 | https://jc-biotechaiteam.com/AptaCom/0058-2/ |
Wen W., et al. "An insertion approach electrochemical aptasensor for mucin 1 detection based on exonuclease-assisted target recycling." Biosensors and Bioelectronics, 71 (2015): 13–17. doi: https://doi.org/10.1016/j.bios.2015.04.001Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | S22 (ID# 8157) | MUC-1 | GCAGTTGATCCTTTGGATACCCTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.010 - 1000 nM | 59 | https://jc-biotechaiteam.com/AptaCom/0059-2/ |
Mashima, T., Lee, JH., Kamatari, Y.O. et al. Development and structural determination of an anti-PrPC aptamer that blocks pathological conformational conversion of prion protein. Sci Rep 10, 4934 (2020).Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | R12-A-12 (ID# 8216) | Bovine PrP | GGAGGAGGAGGAAGGAGGAGGAGGA | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 60 | https://jc-biotechaiteam.com/AptaCom/0060-2/ |
Kotula J, Sullenger B, et al. 2012. Aptamer-mediated delivery of splice-switching oligonucleotides to the nuclei of cancer cells. Nucleic Acid and Therapeutics 22.3:187-195. Li, L. et al. 2014. Aptamer photoregulation in vivo. PNAS 11.48: 17099-103.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Nucleolin aptamer (AS1411) (ID# 7675) | Nucleolin | GGTGGTGGTGGTTGTGGTGGTGGTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 61 | https://jc-biotechaiteam.com/AptaCom/0061-2/ |
Kaur H, Yung L-YL (2012) Probing High Affinity Sequences of DNA Aptamer against VEGF165. PLoS ONE 7(2): e31196. doi:10.1371/journal.pone.0031196Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | VEGF (SL2-B aptamer) (ID# 7688) | VEGF (165) | CAATTGGGCCCGTCCGTATGGTGGGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.5 nM | 62 | https://jc-biotechaiteam.com/AptaCom/0062-2/ |
A Potty et al. Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor. Biopolymers 91(2008):145-155.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti-VEGF165 (ID# 7727) | Recombinant Human Vascular Endothelial Growth Factor | CCCGTCTTCCAGACAAGAGTGCAGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.92 nM | 63 | https://jc-biotechaiteam.com/AptaCom/0063-2/ |
Ruigrok, Vincent J. B., et al. "Kinetic and Stoichiometric Characterisation of Streptavidin-Binding Aptamers." ChemBioChem 13 (2012): 829-836. Print.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | StrepApt5 (ID# 7906) | Streptavidin | GGGAACGCACCGATCGCAGGTTTCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 35 nM | 64 | https://jc-biotechaiteam.com/AptaCom/0064-2/ |
(1) Bogomolova, A., Aldissi, M. ƒ??Real-time and label-free analyte detection in a flow-through mode using immobilized fluorescent aptamer/quantum dots molecular switches.ƒ? Biosensors and Bioelecgtronics, 66 (2015): 290-296. (2) Hesselberth, J., et al. ƒ??In vitro Selection of RNA Molecules That Inhibit the Activity of Ricin A-chain.ƒ? Journal of Biological Chemistry, 275, 7 (2000): 4937-4942.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Ricin A-chain (RTA) Aptamer (RA80.1.d2 – 31RA) (ID# 7953) | Ricin A-chain (RTA) | GGCGAACAGGGGACGAGCAAGACGCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.4 nM | 65 | https://jc-biotechaiteam.com/AptaCom/0065-2/ |
Ellington and Szostak. "Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures." Nature, 355 (1992): 850-852.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Reactive Green 19 (GR-30) (ID# 7502) | Reactive Green 19 | GCAGGGGCGTTCGGGGGGTACCGCTGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 33 µM | 66 | https://jc-biotechaiteam.com/AptaCom/0066-2/ |
K Harada and A Frankel. (1995) Identification of two novel arginine binding DNAs. EMBO J, 14(23): 5798-5811.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | L-arginine (12-79) (ID# 7848) | L-arginine | GACCAGGGCAAACGGTAGGGAGTGGTC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~2.5 mM | 67 | https://jc-biotechaiteam.com/AptaCom/0067-2/ |
Zhang JQ, Wang YS, Xue JH, He Y, Yang HX, Liang J, Shi LF, Xiao XL. A gold nanoparticles-modified aptamer beacon for urinary adenosine detection based on structure-switching/fluorescence-"turning on" mechanism. J Pharm Biomed Anal. 2012 Nov;70:362-8. doi: 10.1016/j.jpba.2012.05.032. Epub 2012 Jun 1. PMID: 22717140.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamer Beacon (ID# 8174) | adenosine | ACCTGGGGGAGTATTGCGGAGGAAGGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 6.0 nM | 68 | https://jc-biotechaiteam.com/AptaCom/0068-2/ |
Fu et al. "An ultrasensitive peroxidase DNAzyme-associated aptasensor that utilizes a target-triggered enzymatic signal amplification strategy." Chemical Communications, 47(2011): 9876-9878.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | DNAzymeMB (Part of Lysozyme Aptasensor) (ID# 7581) | N/A: See additional comments. | AGGGACGGGCTAAGTAACTGTGGAGGGT | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 69 | https://jc-biotechaiteam.com/AptaCom/0069-2/ |
Tesmer et al., Molecular Mechanism for Inhibition of G Protein-Coupled Receptor Kinase 2 by a Selective RNA Aptamer, Structure (2012), doi:10.1016/j.str.2012.05.002Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | GRK2 (C13.28) (ID# 7698) | G protein-coupled receptor kinase 2 | GGCAGACCAUACGGGAGAGAAACUUGCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.2 nM | 70 | https://jc-biotechaiteam.com/AptaCom/0070-2/ |
K Harada and A Frankel. (1995) Identification of two novel arginine binding DNAs. EMBO J, 14(23): 5798-5811.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | L-arginine (12-28 hairpin) (ID# 7847) | L-arginine | GGGATCGAAACGTAGCGCCTTCGATCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | ~2.5 nM | 71 | https://jc-biotechaiteam.com/AptaCom/0071-2/ |
Connor A C, McGown L B, et al. (2006) Insulin Capture by an Insulin-Linked Polymorphic Region G-Quadruplex DNA Oligonucleotide. J Am Chem Soc. 128: 4986-4991.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Insulin-Linked Polymorphic Region Two-Repeat (ILPR2) (ID# 7863) | Insulin | ACAGGGGTGTGGGGACAGGGGTGTGGGG | https://www.aptagen.com/apta-index/ | Peptide | null | null | null | 72 | https://jc-biotechaiteam.com/AptaCom/0072-2/ |
Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, ƒ??RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Methodƒ? Biol. Pharm. Bull. 37(8) 1411-1415 (2014)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Mitomer2 (ID# 7929) | Mitochondria | UCCCGAUUACUGUACAUACCUUAGCCCAUAGCUGGCUGC | https://www.aptagen.com/apta-index/ | Other | null | null | . nM | 73 | https://jc-biotechaiteam.com/AptaCom/0073-2/ |
Chen, K.; Zhou, J.; Shao, Z.; Liu, J.; Song, J.; Wang, R.; Li, J.; Tan, W. Aptamers as Versatile Molecular Tools for Antibody Production Monitoring and Quality Control. J. Am. Chem. Soc. 2020 Jun 9; 142(28): 12079-12086. PMID 32516525. DOI: 10.1021/jacs.9b13370.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | CH1S-3 (ID# 8122) | Trastuzumab | GTCCAGGGTTCCAAGGTGCTTCGTGGAC | https://www.aptagen.com/apta-index/ | Antibody | null | null | 10.3 nM | 74 | https://jc-biotechaiteam.com/AptaCom/0074-2/ |
Wilson C, Szostak J. (1998) Isolation of a fluorophore-specific DNA aptamer with redox activity. Chem Biol. 5(11):609-617.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Sulforhodamine B (Clone 73 – min) (ID# 7549) | Sulforhodamine B | CCGGCCAAGGGTGGGAGGGAGGGGGCCGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 190 nM | 75 | https://jc-biotechaiteam.com/AptaCom/0075-2/ |
Tasset, D. (1997). Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol., 1997(272), 688-698.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Thrombin (29mer) (ID# 7699) | Thrombin | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.5 nM | 76 | https://jc-biotechaiteam.com/AptaCom/0076-2/ |
Development of an Efficient Targeted Cell-SELEX Procedure for DNA Aptamer Reagents Susanne Meyer et al. 2013Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Kit-129 (ID# 7866) | CD117 (c-kit) | GCTCAACGCGGGACGGCTCTCCCATTGAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 12.21 nM | 77 | https://jc-biotechaiteam.com/AptaCom/0077-2/ |
Ruigrok, Vincent J. B., et al. "Kinetic and Stoichiometric Characterisation of Streptavidin-Binding Aptamers." ChemBioChem 13 (2012): 829-836. Print.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | StrepApt 2 (ID# 7905) | Streptavidin | GGGAATCGCCACCCGACGCAGGGTTTCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 77 nM | 78 | https://jc-biotechaiteam.com/AptaCom/0078-2/ |
Byul Nim Oh, Sungeun Lee, Hye-Yeon Park, Jin-Ook Baeg, Moon-Young Yoon, and Jinheung Kim. 2011. Reference: Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties. Analyst, 2011, 136, 3384. DOI: 10.1039/c0an00978dMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | 1-PA (ID# 7917) | Anthrax Protective Antigen (PA) | GATGTGGGTGTAGTTGGAGGGTAAACGTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 8.53 nM | 79 | https://jc-biotechaiteam.com/AptaCom/0079-2/ |
Byul Nim Oh, Sungeun Lee, Hye-Yeon Park, Jin-Ook Baeg, Moon-Young Yoon, and Jinheung Kim. 2011. Reference: Sensitive fluorescence assay of anthrax protective antigen with two new DNA aptamers and their binding properties. Analyst, 2011, 136, 3384. DOI: 10.1039/c0an00978dMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | 2-PA (ID# 7918) | Anthrax Protective Antigen (PA) | CAGACCGTAAGGGATGCCGCCTAAACACC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.51 nM | 80 | https://jc-biotechaiteam.com/AptaCom/0080-2/ |
Hu, L., Wang, L., Lu, W., Zhai, Q., Fan, D., Liu, X., … Chen, W. (2017). Selection, identification and application of DNA aptamers for the detection of Bifidobacterium breve. RSC Advances, 7(19), 11672–11679.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | BB16-11 f (ID# 8210) | Bifidobacterium Breve | CTCCCAGGCCGTTGGGGCGTTGCCTGCGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 18.66 nM | 81 | https://jc-biotechaiteam.com/AptaCom/0081-2/ |
Gelinas, A. D., Tan, T. K., Liu, S., Jaramillo, J. G., Chadwick, J., Harding, A. C., Zhang, C., Ream, B. E., Chase, C. N., Otis, M. R., Lee, T., Schneider, D. J., James, W. S., & Janjic, N. (2023). Broadly neutralizing aptamers to SARS-COV-2: A diverse panel of modified DNA antiviral agents. Molecular Therapy - Nucleic Acids, 31, 370–382. https://doi.org/10.1016/j.omtn.2023.01.008Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | SL1111_20 (ID# 8240) | RBD of SARS-COV-2 Spike protein (monomer or trimer) | GGGATACTATGCGTCCGACCGCTCGGACG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.4-0.5 nM | 82 | https://jc-biotechaiteam.com/AptaCom/0082-2/ |
A Lakamp and M Ouellette. A ssDNA aptamer that blocks the function of the anti-FLAG M2 antibody. J. Nucleic Acids 2011: doi:10.4061/2011/720798Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti-FLAg M2 Antibody Aptamer (ABA) (ID# 7715) | Anti-FLAG M2 Antibody | TCGATTTCCTTAGTTGTCTTCCTTAGTGAG | https://www.aptagen.com/apta-index/ | Protein | null | null | 80 nM | 83 | https://jc-biotechaiteam.com/AptaCom/0083-2/ |
Y-T Lai and J DeStefano. DNA aptamers to human immunodeficiency virus reverse transcriptase selected by a primer-free SELEX method: characterization and comparison with other aptamers. Nucleic Acid Therapeutics 22(2012): 162-176.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HIV Reverse Transcriptase (PF1) (ID# 7781) | HIV RT | AGGAAGGCTTTAGGTCTGAGATCTCGGAAT | https://www.aptagen.com/apta-index/ | Protein | null | null | 80 nM | 84 | https://jc-biotechaiteam.com/AptaCom/0084-2/ |
Yuri Tawaraya, Mamoru Hyodo, Mst Naznin Ara, Yuma Yamada, and Hideyoshi Harashima, ƒ??RNA Aptamers for Targeting Mitochondria Using a Mitochondria-Based SELEX Methodƒ? Biol. Pharm. Bull. 37(8) 1411-1415 (2014)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Mitomer1 (ID# 7928) | Mitochondria | CACCACGAUCACGGUUUCCCUCGCAGGUAAGGUGUAGA | https://www.aptagen.com/apta-index/ | Other | null | null | . nM | 85 | https://jc-biotechaiteam.com/AptaCom/0085-2/ |
Simmons SC, Jamsa H, Silva D, Cortez CM, McKenzie EA, et al. (2014) Anti-Heparanase Aptamers as Potential Diagnostic and Therapeutic Agents for Oral Cancer. PLoS ONE 9(10): e96846. doi:10.1371/journal.pone.0096846Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | 1.5 M Short Anti-Heparanase Aptamer (ID# 7956) | Heparanase | ACTTTTGAATGTGGCAACAAATTCGACAGG | https://www.aptagen.com/apta-index/ | Protein | null | null | n/a nM | 86 | https://jc-biotechaiteam.com/AptaCom/0086-2/ |
Pu, Y.; Zhu, Z.; Han, D.; Liu, H.; Liu, J.; Liao, J.; Zhang, K.; & Tan, W. Insulin-Binding Aptamer-Conjugated Graphene Oxide for Insulin Detection. Analyst, 2011, 136, 4138-4140Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Insulin Binding Aptamer (IBA) (ID# 7960) | Insulin | GGTGGTGGGGGGGGTTGGTAGGGTGTCTTC | https://www.aptagen.com/apta-index/ | Protein | null | null | n/a nM | 87 | https://jc-biotechaiteam.com/AptaCom/0087-2/ |
Minagawa H, Kataoka Y, Fujita H, Kuwahara M, Horii K, Shiratori I, Waga I. Modified DNA Aptamers for C-Reactive Protein and Lactate Dehydrogenase-5 with Sub-Nanomolar Affinities. International Journal of Molecular Sciences. 2020; 21(8):2683. https://doi.org/10.3390/ijms21082683Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | CRP-U^gu4 (ID# 8064) | Human C-reactive protein (CRP) | CAGCGCCAAAGGCGGAAGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 6.2 nM | 88 | https://jc-biotechaiteam.com/AptaCom/0088-2/ |
Park, J., Yang, K.-A., Choi, Y., & Choe, J. K. (2022). Novel ssdna aptamer-based fluorescence sensor for perfluorooctanoic acid detection in water. Environment International, 158, 107000. https://doi.org/10.1016/j.envint.2021.107000Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PFOA Aptamer (ID# 8177) | Polyfluoroalkyl acid (Perfluorooctanoic acid, PFOA) | GGAATCGTGGGTGGTAGGGTAGGGGATGCA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 5.5 nM | 89 | https://jc-biotechaiteam.com/AptaCom/0089-2/ |
Müller, J., Wulffen, B., Pötzsch, B., & Mayer, G. (2007). Multidomain Targeting Generates a High-Affinity Thrombin-Inhibiting Bivalent Aptamer. ChemBioChem, 8(18), 2223–2226. doi:10.1002/cbic.200700535Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | HD1-15dA (ID# 8198) | Thrombin | GGTTGGTGTGGTTGGAAAAAAAAAAAAAAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 50.9 nM | 90 | https://jc-biotechaiteam.com/AptaCom/0090-2/ |
Kozumi and Breaker. "Molecular Recognition of cAMP by an RNA Aptamer." Biochemistry, 39 (2000): 8983-8992.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | cAMP (ID# 7512) | cAMP | GGAAGAGAUGGCGACUAAAACGACUUGUCGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 10 µM | 91 | https://jc-biotechaiteam.com/AptaCom/0091-2/ |
K Ikebukuro et al. Analysis of the evolution of the thrombin-inhibiting DNA aptamers using a genetic algorithm. Biotechnol Lett (2006) 28:1933ƒ??1937.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Thrombin (31mer) (D2-5) (ID# 7787) | Thrombin | AGCGAGTAGGTTGGTGTGGTTGGGGCTCGCT | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 92 | https://jc-biotechaiteam.com/AptaCom/0092-2/ |
"A flexible multiplexed immunosensor for point-of-care in situ wound monitoring", Yuji Gao, et. al. (2021)https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8139589/pdf/abg9614.pdfMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | IL-6 Aptamer (ID# 8228) | Interleukin 6 (IL-6) | GGTGGCAGGAGGACTATTTATTTGCTTTTCT | https://www.aptagen.com/apta-index/ | Protein | null | null | Not given nM | 93 | https://jc-biotechaiteam.com/AptaCom/0093-2/ |
Mengyue Liu, Lingjun Geng, Fengjuan Zhang, Shouyi Dou, Falan Li, Zhanli Liu, Yemin Guo, and Xia SunJournal of Agricultural and Food Chemistry 2022 70 (50), 15990-15998DOI: 10.1021/acs.jafc.2c06167https://pubs.acs.org/doi/abs/10.1021/acs.jafc.2c06167?ref=PDFMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | 2-17-2 (ID# 8236) | E. coli | TCAAGGTCGCAATTTCGAGCAGAACTTAAGA | https://www.aptagen.com/apta-index/ | Cells | null | null | 101.76+/-9.11 nM | 94 | https://jc-biotechaiteam.com/AptaCom/0094-2/ |
Kiga, D., et al. "An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition." Nucleic Acids Research, 26 (1998): 1755-1760.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Xanthine (XAB) (ID# 7511) | Xanthine | GGCACGUGUAUUACCCUAGUGGUCGACGUGCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 3.3 nM | 95 | https://jc-biotechaiteam.com/AptaCom/0095-2/ |
Majerfeld and Yarus. "Isoleucine:RNA sites with associated coding sequence." RNA, 4 (1998): 471-478.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | L-Isoleucine (IL 42-32b) (ID# 7518) | L-Isoleucine | GGUCUUACGUCGUUCGCGACUAUUGGGAGACC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 200 µM | 96 | https://jc-biotechaiteam.com/AptaCom/0096-2/ |
Green L, Jellinek D, Janjic N, et al. (1995) "Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial growth factor." Chem Biol. 2:683-695.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | Vascular Permeability Factor/Vascular Endothelial Growth Factor (NX-213) (ID# 7547) | Vascular Permeability Factor/Vascular Endothelial Growth Factor (VPF/VEGF) | TTTTACCCUGAUGGUAGACGCCGGGGUGTTTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 140 pM | 97 | https://jc-biotechaiteam.com/AptaCom/0097-2/ |
N Savory et al. Selection of DNA aptamer against prostate specific antigen using a genetic algorithm and application to sensing. Biosens. Bioelectron. 26 (2010): 1386-1391.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PSA aptamer (PSap4#5) (ID# 7714) | PSA | TTTTTAATTAAAGCTCGCCATCAAATAGCTTT | https://www.aptagen.com/apta-index/ | Protein | null | null | <100 nM | 98 | https://jc-biotechaiteam.com/AptaCom/0098-2/ |
Mei H et al. (2012) Functional-group specific aptamers indirectly recognizing compounds with alkyl amino group. Anal. Chem. 84: 7323 - 7329Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | p-Nosyl Protected Alkyl Amino Group (M6b-M14) (ID# 7824) | p-nosyl protected alkyl amino groups | ATCATGGTGGGTATCGGCACTCGTTGGTTGAT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 2.27 nM | 99 | https://jc-biotechaiteam.com/AptaCom/0099-2/ |
End of preview. Expand in Data Studio
No dataset card yet
- Downloads last month
- 887